• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The present invention relates to the combination of the promoter/operator region of the tryptophan operon of Serratia marcescens with a synthetic ribosome binding sequence, an expression plasmid which contains this sequence and in which the above sequence is followed by the only Hind III cleavage site in the plasmid, into which site the gene to be expressed can be inserted, and to production plasmids for the expression of eukaryotic gene products in prokaryotes, especially for the preparation of leucocyte interferon.
    公开号:SU1417800A3
    申请号:SU853935004
    申请日:1985-08-02
    公开日:1988-08-15
    发明作者:Дворкин Марк-Брус；Дворкин-Растль Эва；Адольф Гюнтер；Гауель Норберт；Мейндль Петер；Светлы Петер；Хауптманн Рудольф
    申请人:Берингер Ингельгейм Интернациональ Гмбх (Фирма)；
    IPC主号:
    专利说明:

     cm
    The invention relates to genetic engineering, in particular, to a method for producing a plasmid suitable for producing interferon type d.,
    The proposed method of producing plasmid encoding a mature o / interferon
    human, is that the plasmid pER 103, which is obtained by cleaving pBR322 with endonucleases, followed by the removal of the Eco Rl-Hind Ill fragment with a length of 29 Lp and the insertion of the DNA sequence of the formula
    5 AATTCACGCTGATCCCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTC 3 GTGCGACTAGCGATTTTGTAAGACGTTTTTCTCCCAACTGAAACGGAAG
    I Promotor -
    GCGAACCAGTTAAGTAGTACAGAAGTTCACGGCAACGGTAAGGAGGTTTA CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCCATTCCTCCAAATTCGA Promotor / Operator
    20
    as a result of the ligation reaction, after its treatment, Hind IG and phosphatase drank with the linker sequence of the formula
    LinkerI
    AGGTTAAAGATGTGT
    ATTTGTACACAGTAG
    IN FN-o / -Gen
    to which a coding IEN-i sequence is added, and additionally par-Lokus, which was isolated by Eco RI by endonuclease from plasmid pPM 31, or DNA fragment approximately 1300 in length, is introduced into the plasmid thus obtained through the Eco Ri-BamHI linker, obtained by processing 30 plasmids pER33 with the enzymes Eco RI and Vaga HI.
    The final plasmid is transformed into Escherichia coli HB 101, and selected
    25
    DMTr-0ChO
     at
    IG
    Si- (CH2) 3-N-CO- (CH2) 2-CO-0
    OC2Hj
    OS2N5 N
    The specific load is 68–104 µmol nucleoside per 1 g of carrier material.
    EXAMPLE 2.- 5 -Dimexytrityl-deoxythymidine-3-chloromethoxyphosphite.
    Fully protected nucleoside-3 - chloromethoxyphosphites are synthesized according to 50. well-known methods, 544.6 mg (1.0 mmol) of 5-dimethoxytrityl thymidine (DMTrTd; dissolved in 1, O ml of absolute THF and this solution at -78 ° C for 15 min under argon atmosphere is added dropwise to a stirred solution of 0.9 μmol methyldichlorophosphite in 0.5 ml of absolute pyridine and 2.0 ml of absolute
    the desired clones are transformed with the plasmid and cultivated by known methods.
    The image is illustrated by the following examples.
    Example 1. The polymer carrier material is functionalized by known methods. HPLC-silica gel (Macherey SNageL), grain size 20 μm, pore size 200 A) serves as a carrier material. It is derivatized by the method of Mateucci and .Caruthers, except that the succinating step is carried out using succinic anhydride in anhydrous pyridine. The protected nucleosides are thus covalently bonded to silica gel according to the following formula.
    DMTr-0TGF. After 10 min, the reaction solution is heated to room temperature and centrifuged. The supernatant is transferred with a pipette into a dry flask filled with argon and ground (25 ml). At room temperature, the solvent is filtered off with suction in a vacuum, then 0.5 ml of toluene AND THF are added and evaporated again, and a colorless foamed solid remains as product. This product is not analyzed for its purity, but dissolved in 10.0 m absolute pyridine and this solution is stored under argon at -20 ° C until
    / until further use (maximum one week).
    PRI me R 3. 5 -Dimethoxytrityl-N-isobutyryl-deoxyguanosine-3-chloromethoxyphosphite.
    Analogously to Example 2, a solution of this nucleoside phosphorochloridite in 10.0 ml of pyridine from 640.0 mg (1.0 mmol-3-dimethoxytrityl-N-isobutyl-deoxiguanosine is obtained.
    Example4. 5-T T imethoxytrityl mixture n-butanol-dutid
    c) 4 p absolute pyridine;
    d) uncondensation of the nucleotide unit: th solution of 5-dimetok sitimidin-3-chlorometh measure 5) (approximately 100 m
    Q rumble is added to the frit carrier and inbuilt, the reaction time is
    e) make 3 p
    N-benzoyl-deoxycytidine-3-chloromeths - absolute pyridine; syphosphite.
    Analogously to example 2, a solution of this nucleoside phosphorochloridite in 10 is obtained. About 0 ml of pyridine from 683.7 mg (1.0 mmol) of 5-dimethoxytrityl-N 15 e) is carried out with tri-ether using phosphorous power of 100 mg of iodine, 3 ml of THF, meadow (2: 2: 1), reaction time
    benzoyl-gdezoksitsitgidina.
    Example 5 -Dimethoxytrityl-N-benzoyl-deoxyadenosine-3-chlorine 30
    methoxyphosphite,
    Analogously to example 2, a solution of this nucleoside phosphorochloridite in 10.0 ml of pyridine from 657.7 mg (1.0 mmol) of 3 -dimethoxytrityl-S - benzoyl-deoxyadenosine is obtained.
    PRI me R 6. Synthesis of d-TCCTTA.
    50 mg (5 µmol) of a polymeric carrier containing MTrdA (see Example 1) are added to a glass frit. Accordingly, the next step is then added with various solvents and reagent solutions; the carrier in it is shaken briefly and the solution, after the desired interaction, is again removed by displacing it upward through the argon current.
    frit
    H40
    a) Cleave Vgg groups with
    3 ml of a solution of 70 g of zinc bromide, 00 ml of nitromethane and 5 ml of water, reaction time 10 min;
    b) perform 4 washes of 3 ml each
    25
    35
    45
    498
    Load (µmol / g) 2a O2bc (Dilution Factor)
    vehicle weight (mg)
    It is possible to calculate the loading of the carrier material by dimethoxytrityl protecting groups. 43 μmol / g are obtained. This corresponds to an average yield of 83% on. condensation stage.
    Cleavage of methyl residues from phosphate ester groups.
    The carrier material is shaken for 4 min in 4 mp of a solution of thiophenol, triethylamine and dioxane (1: 1: 2),
    a mixture of n-butanol-dutidine-THF (4: 1: 5);
    c) 4 washes were performed with 4 ml each time with absolute pyridine;
    d) non-condensing of the nearest nucleotide unit: 1 mp of pyridine solution of 5-dimethoxytrityl-deoxithymidine-3-chloromethoxyphosphite (example 5) (approximately 100 µmol) under argon, added to the frit to the polymer carrier and shaken in solution, the reaction time is 10 min;
    e) perform 3 washes in 3 ml each
    absolute pyridine;
    e) carry out the oxidation with phosphoric acid tri-ester with 100 mg of iodine dissolved in 3 ml of a mixture of THF, lugidine and water (2: 2: 1), the reaction time is 7 min;
    g) carry out 3 washings of 4 ml each
    THF;
    h) acetylate the unconverted C - OH groups with a solution of 150 mg of 4-dimethylamino-Sridin, 0.3 ml of collidine, 0-, 25 mp of acetic anhydride and 2.5 ml of THF, reaction time 3 minutes;
    and) 4 washes were performed with 3 ml of nitromethane each.
    The cycle from a) to i) is now repeated four times, with the nucleotide building block necessary for the sequence being used in step d).
    After the last nucleotide structural element is condensed, the carrier material is dried in an oil pump vacuum, the sample is suspended to the nearest 1 mg and mixed with 10.0 ml of a 0.1 M solution of toluene sulfonic acid in acetonitrile. By the cleavage of the dimethoxytrityl cation during this process, an orange-red colored solution is obtained, the absorption of which is measured at 498 nm. According to the formula
    498
    50
    55
    then washed with methanol, then with ether.
    The carrier material is heated with 10 ml of concentrated ammonia for 14 hours, the aqueous solution is then filtered off with suction and the filtrate is concentrated under vacuum to about 2 ml.
    The resulting crude product containing a dimethoxytrityl group at the 5'-end is exposed to about 5. 14 ratification of HPLC. Column - Bondapak S. from Waters; eluant: 0.1 M triethylammonium acetate buffer with pH 7 with 25% acetonitrile; the expiration of 2 ml / min; retention time 14 min. The cobalt fractions of the elasis elution are concentrated to approximately 1 ml., mixed with 10 ml of 80% acetic acid and left for 30 min at. room temperature. It is then concentrated in vacuo to dryness, the residue is dissolved in 25 ml of water and the split dimethoxytritanol is extracted 3 times with 15 ml of ether. The aqueous phase is again concentrated to dryness, the residue is dissolved in 2.5 ml of water, desalted on P 2 biogel. (Column: 60 x 1.7 cm) and diofilized.
    An analytical HPLC chart serves as a purity control. Column 300 X 3.9 mm, p-Bondapak from Waters; eluants: 0.1 M Triethyl ™ monoacetate buffer pH 7 with 12% acetonitrile; 1.5 ml / min, retention time 3.7 min.
    Example 7. Synthesis of d-TAAGGAGGTTTA.
    Prepared analogously to example .6 is-od from 300 mg. (30 μmol) DMTrdA -P
    HPLC diagram of the product: column 300 X 3.9 mm, fx-Bondapak С /, manufactured by Waters; eluant 0.1 M triethylammonium acetate buffer with pH 7 with 12% acetone. nitrile; expiration 1.5 il / min; retention time 4.4 min.
    AND ROME ER 8 / Synthesis of d-ACCTTAAACC
    Prepared analogously to example B, starting from 200 mg (16 μmol) of DMTrdC -P.
    HPLC diagram of the product: column 300 X 3.9 mm, (U-Bondapak C (from Waters; eluant 0.1 M triethylammonium acetate buffer pH 7 with 12% acetonitrile; expiration 1.5 ml / min. Retention time .3, 4 minutes PRI and MER 9. Synthesis of d-CATCTTTA.
    Prepared analogously to Example 6, a course of 150 mg (1.32 μmol) of DMTrdA -P.
    HPLC diagram of the product: column 300 X 7.8 mm, | U-Bondapak С g from Waters; eluant: 0.1 M triethylammonium buffer with pH 7 with 20% acetonitrile; 1.5 ml / min; retention time 7.7 minutes
    DI Mer 10, Synthesis of d-AGCTTAAAGATG
    Prepared analogously to example 6, based on .. 200 mg (16.2 μmol). DMTrdG R.
    V
    800 6
    HPLC diagram of the product: column .. 300 X 7.8 mm, | U-Bondapak S. from Waters; eluant 0.1 M triethylammonium acetate buffer, pH 7 with 26% acetonitrile; the expiration .1,5 ml / Min; retention time 5.2 min. . PR and ME 11. Synthesis of d-TGTGATCTGCCTCA;
    Prepared analogously to Example 6 using a 0 mg course of 250 mg (22 μmol) DMTrdA -P.
    HPLC diagram of the product: column 300 X 7.8 mm, (U-Bondapak C, manufactured by Waters; eluant 0.1 M triethylammonium acetate buffer, pH 7 with 25% acetonite-5 reel; after 1.5 ml / min; retention time 6.1 min.
    Example 12. Synthesis of d-CAGATCACA. Prepared analogously to Example 6, baseline, d of 150 mg (13.2 μmol) DMTrdA -P. 0 HPLC product diagram: column 300 X 7.8 mm, wBondapak from Waters; eluant 0.1 M triethylammonium-. acetate buffer pH 7 with 20% acetonitrile; 0.2 ml / min; 5-retention time 5.2 min.
    Sequence analysis of synthetically produced oligodeoxynucleotides is carried out after they are inserted into the interfern-derived plasmid pER 33.-C, and this analysis simultaneously confirms the correctness of the base sequence in the oligooxynucleotides.
    PRA and MER 13. Plasmid pBP 101, which contains approximately a fragment of size O OO Lp encoding the Serratia marcescens tryptophan operon, is the original material for the selection of the promoter-operator region. This regulatory region is located. Inside the Eco RI-Hae Ill fragment, 90 Lp in length, in which the promoter is oriented in the direction of Eco RI-- Hae III.5 from each other by gel electrophoresis (1.4% agarose) and a fragment of 200 Lp in length, electrophoretically elute from the gel. This fragment is then digested with. using Nae III, both digestion products are separated on - 6% polyacrylamide gel and fragment
    5 cop, length 90 Lp (promoter-operator) - again isolated from -gel.
    RBS consists of 3 synthetic oligonucleotides: 6-measure 5 -TCSTTA, 10-measure 5 -AGCTTAAACC, and 12-measure 55
    Q
    7141
    TAAGGAGGTTTA. 500 n-mol 6-measure is phosphorylated with the help of the enzyme full-nucleotide kinase and is labeled radioactively. The reaction mixture is heated for 10 minutes to inactivate the kinase, then equimolar amounts (not phosphorylated) of 10-measure and 12-measure are added, the mixture of oligonucleotides is heated to and then slowly (approximately 3 hours) cooled to 30 - 35 C, moreover, the oligonucleotides are hybrids. zyuyuts one with another:
    12 tag
    dTAAGGAGGTTTA dATTCCTCCAAATTCGA
    bteg 10 ter
    Due to the addition of 0.25 µmol ATP and 5 µmol DTT 6-mer and 10-mer, the enzyme DNA ligase is covalently linked to each other. The absence of phosphate residues at the 5-ends of the 12-mer and 10-mer prevents the occurrence of multidimensional products of the ligature. After the reaction, heating is carried out for 10 minutes in order to inactivate the ligase, after which 0.5 mmol of ATP and 5 mmol of DTT are added, and further kinases are further synthesized, 5-ends of the 12-mer and .10-measure are added. , thanks to what RBS is obtained.
    12 pmol of Eco RI-Hae-III promoter-operator fragment of a length of 90 Lp are ligated under standard conditions with 60 pmol of RBS. The blunt end of a fragment of 90 Lp size obtained by Nae III cut is doped with the blunt end of RBS and molecules containing RBS are obtained in the downward direction from the promoter. After the reaction, the ligase is inactivated for 10 min at, the concentration of TA buffer is established and further digested with 200 units of Hind III and 10 units of Eco RI.
    In the multimers formed in the reaction, along with the gelatal reaction, both the Eco RI ends and the Hind III ends can be ligated with each other and converted into monomers again. The sample is then separated on a 6% polyacrylamide gel and the promoter-operator RBS fragment is cut out of the gel. 100 lp in size, which has
    08
    The Eco RI and Hind Ill-ends are electrophoretically eluted, 1 to be separated from the excess of the unlegated RBS. At the same time, part of the expression plasmid YDA is responsible for the expression.
    Approximately 2 mg of plasmold pBR 322 is cut using restriction
    the enzymes Eco RI and Hind III, and two fragments are formed: - large with 4382 Lp and small with 29 Lp. A large fragment by α-electrophoresis on a 0.8% agarose gel is separated from a small
    fragment, cut out from the gel and elute. Approximately 0.4 pmol of this fragment is then ligated with a 10 (pmol promoter) onepafop-RBS fragment.
    pBR 322 fragment due to its two
    protruding ends cannot be ligated with itself, therefore the promoter-operator RBS fragment can be ligated only in one orientation in the plasmid in
    HindIII site direction, to tetracycline-resistant pBR 322 gene.
    Escherichia coli KB 101 is transformed using the reaction mixture of the latter: ligation in a known manner; transformants are selected on agar plates containing ampicillin. For this, E-.coli HB 101 cells are grown to a density of approximately 2 X 10® cells / ml. The cells are pelletised and suspended in 100 μmol of a solution of CaClj (20 at). After that, the cells are incubated with the reaction mixture of the ligase reaction for 5 min at O - 4 ° C and for 5 min at
    37 ° C. After the addition, 0.5-1 ml of 1-broth is incubated further for 15-30 minutes at 37 ° C. 19 transformants are selected and using Hoo 111-restriction digestions tested for
    their possible content of promoter-operator RBS fragment. The pBR 322 / NaE-W-fragment with a length of 192 Lp is replaced by a 264 Lp-fragment (16 Lp of the size of Hae III with a site at the end in pBR 322
    50
    to the left of the Eco RI site + 103 Lp promoter / operator RBS fragment + - + 145 Lp Hind Ill-place of the slice up to the nearest Nae dIII-place of the slice to the right of it, in 322). Out of 19. The gg of selected transformants 18 have the expected digestion pattern.
    In order to establish the correctness of the designed expression plasmid, one of these plasmids
    9 . . 14
    (pER 103) is subjected to sequential analysis and its position is established in pBR 322. The sequential analysis is carried out according to the method of Mahat and Gilbert in the direction from the Eco Rl site in the direction of Hind III Santa (and above 1), as well as from Hind-III- site in the direction of the Eco RI site (and above it).
    Plasmid pER 103 thus contains the promoter-operator region of the Serratia marce scens tryptophan operon, in combination with synthetic RBS. A new plasmid translates the transcription of the genes that are inserted into its Hind I II site and allows for the efficient translation of these
    transcription products.
     I
    Example 14, Approximately 1 μg of Pst 1-insert 1F17 digestion: using Sau-SA and a 177 lp fragment, which extends from the Sau-site on the NHj-terminal cysteine codon up to the nearest Sau 3A site contains Ava Ill site, It is treated with 1 unit of alkaline phosphatase, and after phosphatase is removed due to extraction with phenol, rum ether is precipitated with ethanol. The fragment is then treated with Ava II, whereby the desired fragment 34 Lp Sau 3A-Ava II and 143 bp fragment are obtained,
    12 ter
    AGCTTAAAGATGTGTiGATCTGCCTCA
    3 ATTTCTACACACTAckc t „j tI I
    Hind sh
    8mer9mer
    Ii
    Mel cyc
    4 synthetic oligonucleotides are obtained, namely 14-mer -
    TGTGATCTGCCTCA, 1 2-mer 5 -AGCTTAAAGATG 9 mer 5 -CAGATCACA and 8 mer 5 -
    SATSTTTA.
    At 250 pmol of 8-mer, 9-mer, and 14-mer phospho-phylated after the kinase inactivate reaction by heating at 95 ° C, 250 pmol of unquantified 12-mer and oligonucleotide mixture is added slowly (approximately
    780010
    Parallel to this, an interferon-specific Ava II fragment with a size of 646 Lp is prepared from plasmid R17, which extends from the Ava 11 site inside the Sau HA HA fragment with a size of 177 lp for the terminal codon. Approximately 0.5 μg of this Ava II fragment of size 646 Lp together with a mixture of
    Q 34 LP and. 143 lr Sau 3A-Ava
    II fragments are incubated with DNA ligature. The resulting Ava II fragments, which are covalently bonded, flank Ava Il-Sau 3A-. 5 fragments. Once the Ava Il-Sau of the HA-fragment is ligated with the Ava II fragment, no other ligurovag can occur in this place. Research institutes, as Sau 3A-ends are dephosphorized. After ligation, heating is carried out for 10 minutes to inactivate the enzyme, then 5 µmol of DTT and 0.25 µmol of AGR and dephosphorylated are added.
    5 Sau for-kines again. The reaction mixture was separated on a 6% polyacrylamide gel and molecules in the range of 700-800 Lp (646 Lp Ava II fragment flanked by two Ava Il-Sau
    0 FOR-fragments) and in the region of 1300– 1500 LP (two with each other ligated to 646 LP Ava II-fragments flanked by Ava Il-Sau FOR-AF fragment) are eluted.
    Obtaining oligonucleotide com35
    complex of formula 14gper
    Sau FOR
    at. within 3 hours) cooled to 35 ° C to allow hybridization of oligonucleotides. Then, after the addition of 5 μmol DTT and 0.25 μmol ATP, the oligonucleotides are ligated to each other. The absence of a phosphate residue at the 5th end of the 12-measure prevents the formation of dimers; the protruding net 14-measure is not self-complementary, it cannot lead to dimerization.
    eleven
    The liquot portion (25 pmol) of the ligated oligonucletide complex is digested with 80 units of SAА in order to obtain the interferonogen-compatible SauA-end. Then the sample is heated for 10 minutes at 75 ° C, extracted with phenol and precipitated with ethanol. Thus, the sequential fragment that binds the interferonogen to the Hind 11G-cut pER 103 according to the invention, is from.
    Binding of interferonogen and oligonucleotide complex, ligation in pER 103..
    The isolated interferon fragments, which are approximately 1 pmol of molecules, are bound to the SauAUT-cut oligonucleotide complex (approximately 25 pmol) by ligating the coagus SauA-Koico.v. Again, the absence of a phosphate residue at the Hind Ill-end of the oligonucleotide complex (12-mer) prevents the occurrence of multimers. Interferonogen molecules are formed, which on both sides of the oligonucleotide complex are flanked by free Hind Ill-ends. After denaturing. by heating ligases and additives 5 µmol DTT and 0.25 µmol ATP. These ends are phosphorylated, then they are precipitated with the aid of an opanol to separate the dimers of the oligonucleotide complex formed in the ligation reaction. Thereafter, the construct is ligated with 0.05 µg of Hind III, treated with endonuclease and phosphate gas of the pER 103 plasmid. Treatment with HindIl phosphatase of the cut plasmid reduces its recirculation in the ligated reaction. Thus, the plasmid mixture is ready; it contains up to 50% of the interferon-plasmid-producing (namely, those plastids that are prepared from the E4 LP Sau 3A-Ava 1G fragment in ligation using the 646 LP Ava II fragment at the beginning .e gene.
    Transformation Es cherichia coli. IV 101 and transformation analysis for the production of interferon.
    The obtained plasmids transform the E. coli strain IV 101. Approximately 20% of the obtained transformants have all of which many are tested for the expression of interferon. For this, about 100 ml of bacterial culture in M9 minimal medium, in which up to 41
    t.

    . -, -
    ten
    15
    20
    thirty
    35
    40
    45
    50
    55
    780012
    all amino acids except tryptophan (20 µg / m, n per amino acid), as well as thiamine (1 µg / ml), glucose (0.2%) and inducer tryptophanone-peronone indole- (3) -acrylic acid (IAA, 20 µg / ml, flush up to optical
    density 0.6-0.8. - Bacteria are pelletised by centrifuging for 10 minutes at 7000 revolutions per 1 minute, washed once with 50 mp Tris-HCl, pH 8, 30 micromolar NaCL and suspended in 1.5 ml of the same buffer. After incubation with 1 mg / ml lysozyme for 30 minutes on ice, the bacteria are frozen and thawed five times and then the cell fragments are removed by centrifuging for 1 hour at 40,000 rpm. The supernatant is sterile filtered off and tested in a test for reducing stains.
    , 73 cells and the virus Vesicular, Stomatitis on interferon activity. Approximately half of all clones
    25 (with inserts) has a significant interferon expression: 2x10 ° units (international standard units) per 1 liter of culture.
    One of these interferon-producing clones (pER 33) is selected and from the promoter-operator region is subjected to sequential α-analysis further down to the interferonogen in order to establish the correctness of the constructed plasmid. A sequential analysis of Nova is carried out according to Mahat and Gilbert from the radioactively labeled at the Z-end of the Eco RI site in the direction of interferonene.
    The pER 103 plasmid contains the promoter-antibody sequence of tryptophanoperone Serratia marcescens in combination with a synthetic sequence of ribosomal binding. The genes inserted into plasmid pER 103 suitably show high expression values. The plasmid pER 103 bacterial strain in E.coli K, BB 10.1 was deposited in the German collection of microorganisms, GrisebachstraBe 8, 3400 Göttingen / FRG, under the number DSM 2773 dated October 27, 1983, according to the Budapest Treaty.
    Pr 15. Measures 2. 2 µg of pER 33 are resolved with the restriction system Eco RI and Vaga HI, thereby forming two fragments of approximately 1300 Lp and approximately 4000 bpi. These fragments are electrophoretic.
    ki on a 1.2% agarose gel. The shorter fragment is separated from the gel by electroelution. The ends of these DNAs, due to the addition of 1.25 nmol of dATP, dGTP, dCTP and atTP, as well as 2 units of the Klenow fragment of DNA polymer, zy 1, are translated into blunt ends. The DNA is purified by extraction with phenol and precipitation from an ethanolic solution and then dissolved in 15 µl of HjO.
    About 15 pmol of Eco-RI-linker are phosphorylated at the 5-termini by the addition of γ-p-ATP and T4 polynucleotide kinase in 5 ml of the reaction solution. After inactivation by heating the kinase, 5 pmol ATP and O, 1 unit of T4 ligase are added and incubated for 16 hours at 14 ° C. The reaction product is purified by precipitation with low molecular weight substances by isopropanol.
    The DNA is then cut with 20 units of the restriction enzyme Eco RI, again purified by precipitation with isopropanol and a solution of yt in 10 µl of water.
    Approximately 2 μg of pER 33 is treated with: restriction enzyme Eco RI. Alkaline phosphatase is then added to remove 5-phosphate residues approximately 5,300 Lp in length, linear DNA by electrophoresis in 1, agarose gel and electroelution are cleaned of residual uncut pER 33. DNA is extracted with phenol and ether, precipitated from ethanol solution and dissolved in 10 μl of water.
    4 μl of the DNA fragment supplied with Eco-RI linkers, which contains the IFNaA gene plus regulatory elements, are ligated with each other with 0.5 μl of the Eco-treated RI and dephosphorylated pER-33 plasmid in 20 μl of the reaction solution with 0.1 units T4 ligase. After incubation for 16 hours at 14 ° C, the enzyme is decomposed by heating at.
    Escherichia coli HB 101 was transformed analogously to example 1. Two of the clones thus obtained were tested analogously to example 2 for the expression of interferon by means of a spot reduction test. While the pER 33 clone contains up to 200 x 10 IFN units per liter of culture, using one of the newer pER 21/1 clones, more than 300 to 10 units per liter of culture are obtained.
    0
    Plasmid pER 21/1: is isolated in large quantities and analyzed by digestion with restriction enzymes with Hind III. So
    j.
    As the DNA introduced into pER 33 instead of Eco RI has two identical Eco RI sites, two orientations of this DNA and pER 21/1 are possible. The restriction enzyme digestion of the pER 21/1 Hind III 21/1 plasmid with parallel-directed interferongens should give fragments of an approximate value of 4100, 950 (2 fragments) and 450 Lp.
    When both are oriented oppositely, the sizes of the fragments are the next 4350, 950 (2 fragments. And 200 lp. Toning is about 2 μg of pER 21/1 using the Hind restriction system
    III and subsequent electrophoresis in
    The 1.4% agarose gel gives fragments of an approximate value of 4100, 950, and 450 Lp. Therefore, both IFNaA genes are oriented parallel to each other.
    Example 16. Approximately 200 pmol Eco RI linker (New England Biolabs. Inc.) In 20 μl of the reaction solution is phosphorylated at the ends with. 9 units of T4 polynucleotide kinase and
    10 pmol of ATP, then the enzyme, is inactivated by heating.
    8 μg of the pPM 31 plasmid is cut with the endonuclease Ava.1. The ends of this cut plasmid by adding 5 pmol dATP, dGTP ,, dTTP, as well as 4 units of the Klenow enzyme fragment of the polymerase 1 are blunt-ended. The DNA is purified by extraction with phenol and precipitation from this
    pitch the solution and dissolve in 40 µl of water.
    Eco RI linker along with possessing linearized and blunt DNA ends in 70 μl of the reaction solution with
    b pmol ATP and 1 unit of T4 ligase is treated for 16 h at 14 ° C. After the enzyme is inactivated, the solution is adjusted to pH 7.6 by heating in solution with 50 mmol NaCl and 50 μmol.
    Tris-C1 and DNA are treated with 300 Eco RI units. After 2 hours incubation, the restriction enzyme is denatured, heated, and the DNA is electrophoretically separated in a 1.4%
    agarose gel. A par-Lokus containing DNA segment of approximately 400 Lp is electroeluted from the gel, purified by extraction with phenol and precipitation from an ethanolic solution and dissolved
    151 ..:
    1) 50 MKJi water. This piece of DNA has specific protrusions at its ends with Eco RI.
    Approximately 2 μg of pER 33 is treated with the restriction enzyme Eco R1. Alkaline phosphate alkaline is then added to remove 5-phosphate residues. Linear DNS length
    5300 Vjp are cleared by electrophoresis in 1.2% agar aeroge gel and electroelution from ocTiiTO4Horo not cut by pER 33.
    The DNA solution is extracted with phenol and ether, precipitated from the ethanolic solution and dissolved in 50 µl of water.
    1 μl of the cut plasmid DNA is ligated with 1 μl of par-Lokus DNA in 20 μl of the reaction solution with 0.1 units of T4 ligase. After incubation for 16 hours at 14 ° C, the enzyme is inactivated by heating. Escherichia coli HB 101 was transformed as in Example 1. Approximately 50 colonies were obtained. An insignificant amount of DNA was isolated from 10 of these colonies and cut with the restriction enzyme Pst 1. From the analysis by electrophoresis in agarose, it follows that all plasmids contain approximately 400 Lp par-Lokus. Choose one of these plasmids and designate par pER 33.
    Analogously to Example 2, bacteria are cultured which contain either pER or par pER 33, and then are tested in a test with a decrease in the spot for interferon content. Both strains show approximately the same level of expression of interferon.
    In the experiment carried out for a long time, which extends to 120 generations of bacteria, the stability of the plasmids pEK 33 pER 33 and Escherichia coli HB 101 is investigated in the absence of selection pressure due to the antibiotic ampicillin. At regular intervals, samples are taken from the culture and bacteria are tested for interferon content.
    It is established from this that pER 33 bacteria containing pER 33, after about 60 generations, produce interferon. Bacteria that contain parpER 33 produce interferon LA after another 120 generations.
    Thus, it is shown that the introduction of par-Lokus in pER 33 (par pER 33)
    17800I
    increases the stability of plasmids in Escherichia col i H15 101.
    five
    权利要求:
    Claims (3)
    [1]
    1. Method for constructing recombinant plasmid DNA pER-33 encoding mature human 0-interferon
    by isolating the promoters of the op-operator region of 90 Lp from the plasmid pBR 101 as a result of processing a DNA fragment encoding a trintophan operon of Serratia marcescens with the size
    5 1000 Lp by endo укле nucleases Eco RI 6-mer 5-CAATTS and Hae III 4-mer 5-GGCC (RBS of three synthetic oligonucleotides)
    0 6-measure 5-TSSTTA, 10-measure 5-. AGCTTAAACC and 12-mer 5 -TAAGGAGGTTTA, followed by ligation with an Eco RI-Nae Ill fragment encoding a promoter-operator region with a ribosomal binding sequence and further incorporation of the promoter-operator RBS fragment into plasmid pBR 322 by using Eco RI-Hind III size 4332 Lp with a promoter-operator-RBS fragment, followed by transformation of the bacterium Escherichia coli by recombinant plasmids obtained and selection of clones containing
     plasmid pBR 103, while the structural fff-interferon gene is obtained as a result of ligaments of anAva II fragment 646 Lp in size from a Pst 1 insert of clone 1F7 with a mixture of fragments of 34 Lp and 143 Lp obtained by processing Pst 1- insertion of clone 1F7, with the SauA endonuclease, phosphorylation of the resulting fragment with a length of 177 LP, followed by treatment with Ava II endonuclease and binding to an oligonucleotide complex constructed from synthetic oligonucleotides 14-measure 5-TGTGATCTGCCTCA, 12-day-4th-4th-4th-4th-4th-4-4-4-4-nd measure 5-CAGATCACA and 8-measure 5-SATSTTTA, phosphorus ligates iruyut and ligated to 0.05 ug Hind III, the cut and phosphatase-treated pER 103, followed by transformation of strain HB 101 E.coli bacteria derived plasmids and selecting clones containing the final plasmid.
    [2]
    2. A method according to claim, V, characterized in that, for the purpose of raising 5
    0
    five
    171417800 8
    neither stability plasmid, plasmid
    [3]
    3. The method according to claim 1, wherein the 33 is treated with Eco RI-endonuclei and with the fact that, for the purpose of elevation n alkaline phosphase, fragment the output (/ -interferon, the ends of Eco
    5300 Lr size is bound to par-Lo-RI-Bara H1 fragment of 1300 Lp size
    kus, which is obtained by the ligiro-plasmid pER 33, blunt the Klenow-fragment of Eco RI of a phosphorylated linker of DNA polymerase I in the presence of
    with 8 μg of the plasmid pPM 31, predvari-dATP, dGTP, dCTP and dTTP and are ligated
    teline split Ava 1-endonuclease with Eco RI phosphorylated linker,
    ZOY and blunted with the help of a fragment, the obtained fragment was inserted into Klenow polymerase I in the presence of the plasmid pER 33, obdATP, dGTP, dCTP and dTTP, obtained with alkaline phosphatase
    the recombinant DNA is transformed to be ligated with earlier
    E. coli strain HB 101 and clones are selected, the genome containing the plasmid par pER 33.
    类似技术:
    公开号 | 公开日 | 专利标题
    SU1417800A3|1988-08-15|Method of constructing recombination plasmoid dna per-33 encoding ripe alpha-interferon of human being
    US5096825A|1992-03-17|Gene for human epidermal growth factor and synthesis and expression thereof
    US5214132A|1993-05-25|Polypeptide derivatives of human granulocyte colony stimulating factor
    IE851475L|1985-12-14|Process for manufacture of thrombin derivatives
    JP6817493B2|2021-01-20|Method for producing single-strand RNA
    EP0225633A2|1987-06-16|Production of thrombin inhibitors
    SU1630616A3|1991-02-23|Method of producing desulfatehirudine
    FI86993C|1992-11-10|A method for protecting a bacterium from a bacteriophage found in nature
    EP0108387B1|1990-05-16|Preparation of recombinant growth releasing factors
    Hostomský et al.1987|Solid-phase assembly of cow colostrum trypsin inhibitor gene
    US5194592A|1993-03-16|Monoclonal antibodies to novel polypeptide derivatives of human granulocyte colony stimulating factor
    EP0133321A1|1985-02-20|DNA gene, process for production thereof and plasmid containing the same
    KR100407835B1|2004-03-09|Regulatory Genes for Nitrile Hydratase Gene Expression
    JP2545377B2|1996-10-16|DNA sequence
    Isono et al.1977|A new ribosomal proteinlocus in Escherichia coli: The gene for protein S6 maps at 97 min
    EP0134673A1|1985-03-20|Improved plasmid vector and use thereof
    JP2587764B2|1997-03-05|Method for producing N-acylneuraminic acid aldolase
    US6410272B1|2002-06-25|Production of thrombin inhibitors
    JPH06319567A|1994-11-22|Phosphoenol pyruvic acid carboxylase gene of soybean
    RU1438240C|1996-03-20|Recombinant plasmid dna ptnf 22
    JP2591713B2|1997-03-19|DNA sequences, recombinant DNA molecules and methods for the production of the enzyme mutarotase from Acinetobacter calcoaceticus
    RU1438241C|1996-03-20|Recombinant plasmid dna ptnf 33
    EP0105521A2|1984-04-18|Novel DNA, microorganism transformed therewith and use thereof
    RU1445193C|1996-03-20|Recombinant plasmid dna pga 23
    JP2516737B2|1996-07-24|Plasmid vector, its production and use
    同族专利:
    公开号 | 公开日
    JP2637328B2|1997-08-06|
    DK576983A|1984-06-25|
    JPH088868B2|1996-01-31|
    EP0115613B1|1991-03-27|
    NO173742C|1994-01-26|
    NO173742B|1993-10-18|
    GR78766B|1984-10-02|
    DD216043A5|1984-11-28|
    DE3382233D1|1991-05-02|
    DK576983D0|1983-12-14|
    IL70523A|1991-08-16|
    MX9202878A|1992-06-30|
    NO834792L|1984-06-25|
    AU2283283A|1984-06-28|
    ES8501798A1|1984-12-01|
    HU202277B|1991-02-28|
    AT62018T|1991-04-15|
    ES533197A0|1985-02-16|
    ES533213A0|1985-06-16|
    AU579991B2|1988-12-22|
    EP0115613A3|1986-07-23|
    FI834700A|1984-06-25|
    UA8035A1|1995-12-26|
    ES8506090A1|1985-06-16|
    ES8504930A1|1985-04-16|
    JPS59162888A|1984-09-13|
    ES8503372A1|1985-02-16|
    KR930005455B1|1993-06-22|
    EP0115613A2|1984-08-15|
    ES533214A0|1985-04-16|
    NZ206700A|1987-11-27|
    FI834700A0|1983-12-21|
    KR840007105A|1984-12-05|
    FI86991C|1992-11-10|
    ES528350A0|1984-12-01|
    JPH05214000A|1993-08-24|
    SU1366064A3|1988-01-07|
    FI86991B|1992-07-31|
    DE3247922A1|1984-06-28|
    ZA839519B|1985-08-28|
    IL70523D0|1984-03-30|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    ZA811368B|1980-03-24|1982-04-28|Genentech Inc|Bacterial polypedtide expression employing tryptophan promoter-operator|
    DE3176011D1|1980-06-12|1987-04-23|Japan Found Cancer|Plasmid|
    ZA814375B|1980-07-01|1982-07-28|Hoffmann La Roche|Interferons and process for their preparation|
    IE52755B1|1980-08-26|1988-02-17|Univ California|Bovine pre-growth and growth hormone|
    DE3280127D1|1981-03-27|1990-04-12|Ici Plc|GENETICALLY MODIFIED MICROORGANISMS.|
    DE3220116C2|1982-05-28|1993-02-18|Dr. Karl Thomae Gmbh, 7950 Biberach, De|
    DE3247923A1|1982-12-24|1984-06-28|Dr. Karl Thomae Gmbh, 7950 Biberach|Oligonucleotides and process for their preparation|US6291662B1|1984-12-05|2001-09-18|Amgen Inc.|Recombinant methods for production of serine protease inhibitors and DNA sequences|
    DE3584198D1|1984-08-01|1991-10-31|Boehringer Ingelheim Int|NEW GENETIC SEQUENCES CODED BY TYPE I INTERFERON PEPTIDES AND THESE PRODUCING ORGANISMS.|
    DE3587875T3|1984-12-06|2003-01-02|Amgen Inc N D Ges D Staates De|RECOMBINANT METHOD FOR THE PRODUCTION OF SERINE PROTEASE INHIBITORS AND DNA SEQUENCES THEREFOR.|
    FI90990C|1984-12-18|1994-04-25|Boehringer Ingelheim Int|Recombinant DNA molecule, transformed host organism, and method for producing interferon|
    DK151585D0|1985-04-03|1985-04-03|Nordisk Gentofte|DNA sequence|
    DK156072C|1985-04-03|1989-11-06|Nordisk Gentofte|SYNTHETIC DNA SEQUENCE CONTAINING A RIBO BINDING SITE|
    DE3514113A1|1985-04-19|1986-10-23|Hoechst Ag, 6230 Frankfurt|CHANGE OF THE DNA SEQUENCE BETWEEN SHINE-DALGARNO SEQUENCE AND START CODON OF THE TRP OPERON TO INCREASE PROTEIN EXPRESSION|
    US4874703A|1985-08-26|1989-10-17|Eli Lilly And Company|Expression vectors for use in E. coli|
    DE3607835A1|1986-03-10|1987-09-24|Boehringer Ingelheim Int|HYBRID INTERFERONS, THEIR USE AS MEDICINAL PRODUCTS AND AS INTERMEDIATE PRODUCTS FOR THE PRODUCTION OF ANTIBODIES AND THE USE THEREOF AND METHOD FOR THEIR PRODUCTION|
    DE3642096A1|1986-12-10|1988-06-16|Boehringer Ingelheim Int|HORSEINTERFERON|
    GB8813032D0|1988-06-02|1988-07-06|Boehringer Ingelheim Int|Antiviral pharmaceutical composition|
    WO1990005186A1|1988-11-04|1990-05-17|The Upjohn Company|Somatotropin expression using a serratia promoter|
    EP0626448A3|1993-05-26|1998-01-14|BOEHRINGER INGELHEIM INTERNATIONAL GmbH|Process for preparing and purifying alpha-interferon|
    US5531880A|1994-09-13|1996-07-02|Microelectronics And Computer Technology Corporation|Method for producing thin, uniform powder phosphor for display screens|
    FR2724665B1|1994-09-16|1996-12-20|Rhone Poulenc Rorer Sa|PROCESS FOR PRODUCING RECOMBINANT PROTEINS, PLASMIDS AND MODIFIED CELLS|
    法律状态:
    优先权:
    申请号 | 申请日 | 专利标题
    DE19823247922|DE3247922A1|1982-12-24|1982-12-24|DNA SEQUENCES, THEIR PRODUCTION, PLASMIDES CONTAINING THESE SEQUENCES AND THE USE THEREOF FOR THE SYNTHESIS OF EUKARYOTIC GENE PRODUCTS IN PROKARYOTS|
    [返回顶部]